DNAreplication | Python Fiddle

def skew(genome):
    '''
    Input: A String genome
    Output: A list consisting of Skew_i(Genome) (as i ranges from 0 to |Genome|) being Skew_i(Genome) the difference
            between the total number of occurrences of G and the total number of occurrences of C in the first i 
            nucleotides of Genome. 
    
    '''
    values = [0]
    
    for nucleotide in genome:
        if nucleotide == "C":
            values.append(values[-1] -1)
        elif nucleotide == "G":
            values.append(values[-1] +1)
        else:
            values.append(values[-1])
            
    return values

def minimun_skew(genome):
    '''
    Input: A DNA string genome.
    Output: All integer(s) i minimizing Skew_i(Genome) among all values of i (from 0 to |Genome|).
    
    '''
    skew_list = skew(genome)
    minimun = min(skew_list)
        
    return [i for i, value in enumerate(skew_list) if value == minimun]

def hamming_distance(string1, string2):
    '''
	Compute the Hamming distance between two strings.
    Input: Two strings of equal length.
    Output: The Hamming distance between these strings, i.e. the number of mismatches
    
    '''
    count = 0
    
    for index in range(len(string1)):
        if not string1[index] == string2[index]:
            count += 1
            
    return count

def approximate_pattern_matching(pattern, text, d): 
    '''
    Find all approximate occurrences of a pattern in a string.
    Input: Strings pattern and text along with an integer d.
    Output: All starting positions where pattern appears as a substring of text with at most d mismatches.
    
    '''
    positions = []
    
    for index in range(len(text) - len(pattern) + 1):
        if hamming_distance(text[index: index + len(pattern)], pattern) <= d:
            positions.append(index)
            
    return positions
            
#print approximate_pattern_matching("AAA","TTTTTTAAATTTTAAATTTTTT",2)   
#print approximate_pattern_matching("GAGCGCTGG","GAGCGCTGGGTTAACTCGCTACTTCCCGACGAGCGCTGTGGCGCAAATTGGCGATGAAACTGCAGAGAGAACTGGTCATCCAACTGAATTCTCCCCGCTATCGCATTTTGATGCGCGCCGCGTCGATT", 2)   
#print approximate_pattern_matching("AATCCTTTCA","CCAAATCCCCTCATGGCATGCATTCCCGCAGTATTTAATCCTTTCATTCTGCATATAAGTAGTGAAGGTATAGAAACCCGTTCAAGCCCGCAGCGGTAAAACCGAGAACCATGATGAATGCACGGCGATTGCGCCATAATCCAAACA", 3)    
#print approximate_pattern_matching("CCGTCATCC","CCGTCATCCGTCATCCTCGCCACGTTGGCATGCATTCCGTCATCCCGTCAGGCATACTTCTGCATATAAGTACAAACATCCGTCATGTCAAAGGGAGCCCGCAGCGGTAAAACCGAGAACCATGATGAATGCACGGCGATTGC", 3)

Python Fiddle

Python Cloud IDE